|
Oxford Instruments
1998 n a graphpad prism graphpad software inc ![]() 1998 N A Graphpad Prism Graphpad Software Inc, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1998 n a graphpad prism graphpad software inc/product/Oxford Instruments Average 99 stars, based on 1 article reviews
1998 n a graphpad prism graphpad software inc - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
Neuromatic Devices
neuromatic igor plugin ![]() Neuromatic Igor Plugin, supplied by Neuromatic Devices, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/neuromatic igor plugin/product/Neuromatic Devices Average 86 stars, based on 1 article reviews
neuromatic igor plugin - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
wavemetrics inc
igor pro 6 ![]() Igor Pro 6, supplied by wavemetrics inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/igor pro 6/product/wavemetrics inc Average 90 stars, based on 1 article reviews
igor pro 6 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
wavemetrics inc
igor pro 8 ![]() Igor Pro 8, supplied by wavemetrics inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/igor pro 8/product/wavemetrics inc Average 90 stars, based on 1 article reviews
igor pro 8 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
wavemetrics inc
igor pro 7 ![]() Igor Pro 7, supplied by wavemetrics inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/igor pro 7/product/wavemetrics inc Average 90 stars, based on 1 article reviews
igor pro 7 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
wavemetrics inc
igor pro software ![]() Igor Pro Software, supplied by wavemetrics inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/igor pro software/product/wavemetrics inc Average 90 stars, based on 1 article reviews
igor pro software - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
InstruTech inc
itc-18 ![]() Itc 18, supplied by InstruTech inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/itc-18/product/InstruTech inc Average 90 stars, based on 1 article reviews
itc-18 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Borland International Inc
quattro pro 4x ![]() Quattro Pro 4x, supplied by Borland International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quattro pro 4x/product/Borland International Inc Average 90 stars, based on 1 article reviews
quattro pro 4x - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
wavemetrics inc
igor8 ![]() Igor8, supplied by wavemetrics inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/igor8/product/wavemetrics inc Average 90 stars, based on 1 article reviews
igor8 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
wavemetrics inc
igor pro ![]() Igor Pro, supplied by wavemetrics inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/igor pro/product/wavemetrics inc Average 90 stars, based on 1 article reviews
igor pro - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Distinct Hippocampal Pathways Mediate Dissociable Roles of Context in Memory Retrieval
doi: 10.1016/j.cell.2016.09.051
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: N/A TTX Latoxan, Valence, France L8503 CNQX Tocris Bioscience, Bristol, UK 1045 R-CPP Tocris Bioscience, Bristol, UK 0247 QX-314 Tocris Bioscience, Bristol, UK 2313 Picrotoxin Sigma-Aldrich P1675 Fetal bovine serum (FBS) Hyclone SH30070.03 Critical Commercial Assays Rapid DNA Ligation Kit Roche 11 635 379 001 Plasmid DNA Purification MACHEREY-NAGEL N/A Endotoxin-free Plasmid DNA Purification MACHEREY-NAGEL N/A In-Fusion HD cloning kit Clontech 639649 Experimental Models: Cell Lines B7GG Callaway E., Salk Institute N/A BHK-EnVA Callaway E., Salk Institute N/A HEK293-TVA Young J., Salk Institute N/A HEK293T Callaway E., Salk Institute N/A Experimental Models: Organisms/Strains C57BL6/J Harlan Ltd N/A hCAR (transgenic expression of a truncated human receptor for CAV-Cre) Pettersson, S., Karolinska Institutet, Tallone et al., 2001 N/A LSL-R26 Tva-lacZ (Rosa-LSL-TVA, Cre-dependent TVA expression) Saur, D., Technische Universitat Munchen, Seidler et al., 2008 N/A GAD2 Cre Huang, Z. J., Cold Spring Harbor Laboratory, Taniguchi et al., 2011 N/A GAD2 Cre ::LSL-R26 Tva-lacZ (GAD2-Cre-TVA) This paper N/A C57BL6/J::hCAR (F1) This paper N/A Recombinant DNA pSADΔG-ArchT-GFP This paper N/A pAAV-EF1α-DIO-rabG This paper N/A pcDNA-B19N Callaway E., Salk Institute N/A pcDNA-B19P Callaway E., Salk Institute N/A pcDNA-B19L Callaway E., Salk Institute N/A pcDNA-B19G Callaway E., Salk Institute N/A pSADΔG-F3 Callaway E., Salk Institute N/A Sequence-Based Reagents NheI-covering forward primer for Rabies G (GGCCAAGCTAGCATGGTTCCTCAGGCTCTCCTGT) Sigma-Aldrich N/A AscI-covering reverse primer for Rabies G (TTAAGGCGCGCCTTACAGTCTGGTCTCACCCCC) Sigma-Aldrich N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Fiji 1.48 http://fiji.sc/ TrackEM plugin in Fiji 1.48 Cardona A. and Saalfeld S. http://imagej.net/TrakEM2 Turboreg plugin in ImageJ Thévenaz et al.,
Techniques: Recombinant, Polymer, Plasmid Preparation, DNA Ligation, DNA Purification, Cloning, Transgenic Assay, Expressing, Sequencing, Software, Microscopy